Feature Request: Saving certain Web Pages doesn't work (but works in Chrome)

Won’t fix Issue #563170

Open new issue

Browse all tracked issues

Details

Created
Jun 30, 2014
Privacy
This issue is public.
Reports
Reported by 0 people

Sign in to watch or report this issue.

Steps to reproduce

URL:

Repro Steps:

(1) go to this web page:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

(2) copy and paste this DNA sequence (you can use any sequence) and click “BLAST” (at the bottom)
ATGTAGGCTGTCCGCGTAGATGTGTCCGCGCTTATAGTGAGTCTGCCCTTGAACCTCTGTGCGTAGTTTGTTCTAGAGGCGCTGAGCTCGACTCTTCCCATCCATTCAAGTCCTTGTCCAGGGGCCTGGCGCACCCAGGAGAAAGCGCTGCCGGCGGATCCGCCTCCAGATCCCTTGCAGGAGACCTTCACCGAGGACCCAGGCTTCCTCACCTCAGCCTCAGACTGCACCAGCTGGACCTGGGGACTGGGACACCTGTAGCTGCTGCCACCACAAAGAGGATCCTCCAGGTCCAGTCCACCGAATTCACGGCCGGCTGGGCGCA

(3) Wait for the colorful results. The page may update several times while the job is queued. The final page will have “Graphic Summary” on it.

(4) Save the web page in MHT or web-page complete format. Neither will save correctly.
Both Chrome and Firefox store the page correctly.

Expected Results:

saved mht or html complete file should render back to the original page, like printing it.
IE appears to completely ignore the entire page when it is saved.
Bug is also in CHTMLView MFC C++ class.

Actual Results:

Dev Channel specific:

No

 
 
 

Attachments

0 attachments

    Comments and activity

    • Microsoft Edge Team

      Bug M. Jun 30, 2014 2014-06-30T14:57:19.24Z

      Changed Assigned To to “Kamen M.”

      Bug M. Jul 16, 2014 2014-07-16T04:44:25.153Z

      Changed Assigned To to “Venkat K.”

      Ravinder K. Jul 17, 2014 2014-07-17T10:12:48.15Z

      Changed Steps to Reproduce

      Rahul U. Jul 17, 2014 2014-07-17T10:20:30.84Z

      Changed Steps to Reproduce

      David W. Jul 18, 2014 2014-07-18T21:30:56.527Z

      Changed Assigned To from “Venkat K.” to “IE F.”

      David W. Jul 18, 2014 2014-07-18T21:30:56.527Z

      Changed Status to “Won’t fix”

      Venkat K. Aug 15, 2015 2015-08-15T20:54:32.333Z

      Changed Assigned To to “David W.”

      Venkat K. Aug 15, 2015 2015-08-15T20:54:32.333Z

      Changed Status from “Won’t fix”

      David W. Sep 28, 2015 2015-09-28T22:02:18.87Z

      Changed Title from “Saving certain Web Pages doesn't work (but works in Chrome)” to “Feature Request: Saving certain Web Pages doesn't work (but works in Chrome)”

      Rob T. Oct 6, 2015 2015-10-06T16:47:26.967Z

      Changed Assigned To from “David W.” to “Rob T.”

      Prekshi G. Aug 18, 2016 2016-08-18T23:55:27.587Z

      Changed Steps to Reproduce

      Jatinder M. Aug 11, 2017 2017-08-11T16:13:15.733Z

      Changed Assigned To from “Rob T.” to “Ali A.”

      Scott L. Nov 3, 2017 2017-11-03T17:06:11.613Z

      Changed Assigned To from “Ali A.” to “Scott L.”

      Scott L. Nov 3, 2017 2017-11-03T17:06:11.613Z

      Changed Status to “Won’t fix”

    You need to sign in to your Microsoft account to add a comment.

    Sign in