Feature Request: Saving certain Web Pages doesn't work (but works in Chrome)

Issue #563170 • Assigned to Rob T.

Details

Created
Jun 30, 2014
Privacy
This issue is public.
Reports
Reported by 0 people

Sign in to watch or report this issue.

Steps to reproduce

URL:

Repro Steps:

(1) go to this web page:
http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&PAGE_TYPE=BlastSearch&LINK_LOC=blasthome

(2) copy and paste this DNA sequence (you can use any sequence) and click “BLAST” (at the bottom)
ATGTAGGCTGTCCGCGTAGATGTGTCCGCGCTTATAGTGAGTCTGCCCTTGAACCTCTGTGCGTAGTTTGTTCTAGAGGCGCTGAGCTCGACTCTTCCCATCCATTCAAGTCCTTGTCCAGGGGCCTGGCGCACCCAGGAGAAAGCGCTGCCGGCGGATCCGCCTCCAGATCCCTTGCAGGAGACCTTCACCGAGGACCCAGGCTTCCTCACCTCAGCCTCAGACTGCACCAGCTGGACCTGGGGACTGGGACACCTGTAGCTGCTGCCACCACAAAGAGGATCCTCCAGGTCCAGTCCACCGAATTCACGGCCGGCTGGGCGCA

(3) Wait for the colorful results. The page may update several times while the job is queued. The final page will have “Graphic Summary” on it.

(4) Save the web page in MHT or web-page complete format. Neither will save correctly.
Both Chrome and Firefox store the page correctly.

Expected Results:

saved mht or html complete file should render back to the original page, like printing it.
IE appears to completely ignore the entire page when it is saved.
Bug is also in CHTMLView MFC C++ class.

Actual Results:

Dev Channel specific:

No

 
 
 

Attachments

0 attachments

    Comments and activity

    • Microsoft Edge Team

      Changed Assigned To to “Kamen M.”

      Changed Assigned To to “Venkat K.”

      Changed Steps to Reproduce

      Changed Steps to Reproduce

      Changed Assigned To from “Venkat K.” to “IE F.”

      Changed Status to “Won’t fix”

      Changed Assigned To to “David W.”

      Changed Status from “Won’t fix”

      Changed Title from “Saving certain Web Pages doesn't work (but works in Chrome)” to “Feature Request: Saving certain Web Pages doesn't work (but works in Chrome)”

      Changed Assigned To from “David W.” to “Rob T.”

      Changed Steps to Reproduce

    You need to sign in to your Microsoft account to add a comment.

    Sign in